ID: 1152587279_1152587287

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1152587279 1152587287
Species Human (GRCh38) Human (GRCh38)
Location 17:81194682-81194704 17:81194705-81194727
Sequence CCTGCCCCCCGGGTCACGGCAGA AGCCGCAGCGGAGGCCGTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114} {0: 1, 1: 0, 2: 0, 3: 8, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!