ID: 1152588119_1152588126

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1152588119 1152588126
Species Human (GRCh38) Human (GRCh38)
Location 17:81198114-81198136 17:81198135-81198157
Sequence CCTCGCTGGCCCAGGCGTATCTG TGCCCCTGTGATGGGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98} {0: 1, 1: 0, 2: 3, 3: 29, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!