ID: 1152590826_1152590831

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1152590826 1152590831
Species Human (GRCh38) Human (GRCh38)
Location 17:81211179-81211201 17:81211209-81211231
Sequence CCACGCTGGGGCCACAGAGGCCC TTCCTCATTCAATCCCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 324} {0: 1, 1: 0, 2: 3, 3: 13, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!