ID: 1152592071_1152592078

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1152592071 1152592078
Species Human (GRCh38) Human (GRCh38)
Location 17:81218650-81218672 17:81218674-81218696
Sequence CCAGGCTTTGGGAACCTGCTTGG CCAAGGGTCCGCTACTGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 20, 4: 255} {0: 1, 1: 0, 2: 1, 3: 2, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!