ID: 1152594449_1152594453

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1152594449 1152594453
Species Human (GRCh38) Human (GRCh38)
Location 17:81231645-81231667 17:81231677-81231699
Sequence CCAAGCTCAACTCCTGCTGACAG GCCACCACCTCGACCCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 194} {0: 1, 1: 0, 2: 2, 3: 17, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!