ID: 1152594479_1152594482

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1152594479 1152594482
Species Human (GRCh38) Human (GRCh38)
Location 17:81231738-81231760 17:81231754-81231776
Sequence CCACTCCTGTCTCGCATGGGGGA TGGGGGAGAACCTGGAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128} {0: 1, 1: 0, 2: 6, 3: 34, 4: 409}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!