ID: 1152595716_1152595718

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1152595716 1152595718
Species Human (GRCh38) Human (GRCh38)
Location 17:81236682-81236704 17:81236699-81236721
Sequence CCTGAGCGCGTGCGCGGCCCCTG CCCCTGTACCTGCAGCTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141} {0: 1, 1: 0, 2: 0, 3: 25, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!