ID: 1152596716_1152596721

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1152596716 1152596721
Species Human (GRCh38) Human (GRCh38)
Location 17:81241407-81241429 17:81241453-81241475
Sequence CCCGTTTTAAAACACTCTCACTA AAGCCTGCAGACCTTGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 252} {0: 1, 1: 0, 2: 2, 3: 18, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!