ID: 1152604740_1152604745

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1152604740 1152604745
Species Human (GRCh38) Human (GRCh38)
Location 17:81283442-81283464 17:81283457-81283479
Sequence CCCCAAGTCGCCGATCACGACGT CACGACGTAGAAGGCGATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 3} {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!