ID: 1152608559_1152608581

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1152608559 1152608581
Species Human (GRCh38) Human (GRCh38)
Location 17:81304830-81304852 17:81304882-81304904
Sequence CCTGGCCTGTCTGCCCTCTGCCG CGGTGGTCCCATGGCCAGACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 40, 4: 438} {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!