ID: 1152627974_1152627987

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1152627974 1152627987
Species Human (GRCh38) Human (GRCh38)
Location 17:81396939-81396961 17:81396976-81396998
Sequence CCTCCGGCGCGGCCTCTCCTGGA GGGCCCCGGGCCTCGGCACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 141} {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!