ID: 1152638500_1152638513

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1152638500 1152638513
Species Human (GRCh38) Human (GRCh38)
Location 17:81439880-81439902 17:81439922-81439944
Sequence CCCTCTCTTGGCTGCCCCTCAGC CTCACTCCAGGACCTCTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 385} {0: 1, 1: 0, 2: 2, 3: 23, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!