ID: 1152640422_1152640433

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1152640422 1152640433
Species Human (GRCh38) Human (GRCh38)
Location 17:81447141-81447163 17:81447163-81447185
Sequence CCCCGGGGGCCCAGCCTGAGCCC CACAAGGACATTCCTGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 465} {0: 1, 1: 0, 2: 0, 3: 20, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!