ID: 1152643206_1152643225

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1152643206 1152643225
Species Human (GRCh38) Human (GRCh38)
Location 17:81457717-81457739 17:81457769-81457791
Sequence CCAGGAGGGAGGGCAGGGGTTGC CTGGGTAATCAGGAGGGGGAGGG
Strand - +
Off-target summary {0: 5, 1: 4, 2: 11, 3: 74, 4: 609} {0: 1, 1: 2, 2: 0, 3: 33, 4: 493}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!