ID: 1152650026_1152650036

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1152650026 1152650036
Species Human (GRCh38) Human (GRCh38)
Location 17:81488413-81488435 17:81488433-81488455
Sequence CCTGTTGCCGTTTCCGGCGCCCG CCGGGGCCTCCGGGATGTTCCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 8, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!