ID: 1152652636_1152652645

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1152652636 1152652645
Species Human (GRCh38) Human (GRCh38)
Location 17:81502657-81502679 17:81502709-81502731
Sequence CCGCCAGCAGGGAGCTGGACAGC GATTCCAAACGACCACCAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!