ID: 1152656235_1152656244

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1152656235 1152656244
Species Human (GRCh38) Human (GRCh38)
Location 17:81520283-81520305 17:81520310-81520332
Sequence CCCTGAAGGTGGAGAGGCCCGAG GGTCACACCATGCCCAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 188} {0: 1, 1: 0, 2: 1, 3: 22, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!