ID: 1152659169_1152659181

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1152659169 1152659181
Species Human (GRCh38) Human (GRCh38)
Location 17:81534538-81534560 17:81534578-81534600
Sequence CCTCCCCCAGGGGTCCTGGGAGA GGGAAAGCTGCAGAGGTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 402} {0: 1, 1: 1, 2: 3, 3: 33, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!