|
Left Crispr |
Right Crispr |
| Crispr ID |
1152673813 |
1152673823 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:81626220-81626242
|
17:81626270-81626292
|
| Sequence |
CCAGGAAAACCGCTTGAACCCCG |
CGCGCCACTGCACTCCAGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 13, 3: 316, 4: 1009} |
{0: 27510, 1: 122628, 2: 238905, 3: 218800, 4: 128299} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|