ID: 1152675372_1152675376

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1152675372 1152675376
Species Human (GRCh38) Human (GRCh38)
Location 17:81637385-81637407 17:81637411-81637433
Sequence CCAAACTTCTCTCCATGCACAGG GTAGAGAAACAATTTCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 204} {0: 1, 1: 0, 2: 5, 3: 30, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!