ID: 1152681026_1152681036

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1152681026 1152681036
Species Human (GRCh38) Human (GRCh38)
Location 17:81667996-81668018 17:81668044-81668066
Sequence CCAAAGCTAAAGCAGTGGCTGGC GAGGCTTGGAAGGAGGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 172} {0: 1, 1: 0, 2: 3, 3: 48, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!