ID: 1152720519_1152720525

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1152720519 1152720525
Species Human (GRCh38) Human (GRCh38)
Location 17:81921415-81921437 17:81921438-81921460
Sequence CCGCTGCACAAAACCTCACCAGG CACGGACGACACCACGGCACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 172} {0: 1, 1: 0, 2: 1, 3: 2, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!