ID: 1152728784_1152728791

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1152728784 1152728791
Species Human (GRCh38) Human (GRCh38)
Location 17:81960120-81960142 17:81960136-81960158
Sequence CCCACGCCCAAGTCTCCCGCTGT CCGCTGTCCCCGGCTGTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84} {0: 1, 1: 0, 2: 1, 3: 23, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!