ID: 1152735570_1152735581

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1152735570 1152735581
Species Human (GRCh38) Human (GRCh38)
Location 17:81995396-81995418 17:81995431-81995453
Sequence CCTCCCTTGAGGGGATGAGCCAC CCAGGCCCAGCACTGTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115} {0: 1, 1: 1, 2: 4, 3: 53, 4: 453}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!