ID: 1152736701_1152736708

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1152736701 1152736708
Species Human (GRCh38) Human (GRCh38)
Location 17:82000808-82000830 17:82000825-82000847
Sequence CCGGCGCCCCCTGGCCCTGTCTT TGTCTTTGAAGTGCCTCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 341} {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!