ID: 1152739067_1152739076

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152739067 1152739076
Species Human (GRCh38) Human (GRCh38)
Location 17:82011233-82011255 17:82011258-82011280
Sequence CCGGGCGGCAGCAGCCCAAGGTC AGGGGCCTCCCCCAGGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 213} {0: 1, 1: 0, 2: 3, 3: 25, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!