ID: 1152743933_1152743943

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1152743933 1152743943
Species Human (GRCh38) Human (GRCh38)
Location 17:82030774-82030796 17:82030794-82030816
Sequence CCCCCGTGAGGACCCTGAGCCCC CCCCCAAAGTGAGACAGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 224} {0: 1, 1: 0, 2: 1, 3: 21, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!