ID: 1152744132_1152744150

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1152744132 1152744150
Species Human (GRCh38) Human (GRCh38)
Location 17:82031462-82031484 17:82031510-82031532
Sequence CCCGTAGGAGACCCCCGGGCCGG CAGCTCGCGCAGCTCTGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 78} {0: 1, 1: 0, 2: 0, 3: 18, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!