ID: 1152750764_1152750771

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1152750764 1152750771
Species Human (GRCh38) Human (GRCh38)
Location 17:82061475-82061497 17:82061510-82061532
Sequence CCCATCAGAGCAGACTGGGATTG TGTGAACAGCACCATGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 102} {0: 1, 1: 1, 2: 42, 3: 219, 4: 683}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!