ID: 1152751624_1152751640

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1152751624 1152751640
Species Human (GRCh38) Human (GRCh38)
Location 17:82065147-82065169 17:82065188-82065210
Sequence CCTTCTAAGGCCGCTCCAGTACC GGGGCACTAAAGGCGGGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40} {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!