ID: 1152751627_1152751637

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152751627 1152751637
Species Human (GRCh38) Human (GRCh38)
Location 17:82065157-82065179 17:82065182-82065204
Sequence CCGCTCCAGTACCACCGTTGGGT CACGCGGGGGCACTAAAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 54} {0: 1, 1: 0, 2: 0, 3: 4, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!