ID: 1152754931_1152754938

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1152754931 1152754938
Species Human (GRCh38) Human (GRCh38)
Location 17:82083255-82083277 17:82083271-82083293
Sequence CCTCCACCTGGGCCCCATGGAAC ATGGAACACCGTGCACTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 237} {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!