ID: 1152758711_1152758726

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1152758711 1152758726
Species Human (GRCh38) Human (GRCh38)
Location 17:82097718-82097740 17:82097745-82097767
Sequence CCCGTTCCTCCCTCGCGGCGTCC CGGGCTGGGCCTCGGCTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 163} {0: 1, 1: 0, 2: 2, 3: 35, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!