ID: 1152771897_1152771904

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1152771897 1152771904
Species Human (GRCh38) Human (GRCh38)
Location 17:82175170-82175192 17:82175207-82175229
Sequence CCAAAAGGAAGAAAGAATTCTCC CATGAGGGGTAGACCCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 555} {0: 1, 1: 0, 2: 1, 3: 18, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!