ID: 1152772620_1152772631

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1152772620 1152772631
Species Human (GRCh38) Human (GRCh38)
Location 17:82179586-82179608 17:82179609-82179631
Sequence CCCCCAGAGCAAGTGCAGAGCAG GGTGGACCCAGCCACGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 209} {0: 1, 1: 1, 2: 3, 3: 27, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!