ID: 1152773967_1152773975

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1152773967 1152773975
Species Human (GRCh38) Human (GRCh38)
Location 17:82188337-82188359 17:82188382-82188404
Sequence CCTGCAGCTGCTCCACGTGGGCT CATCCTTCTCCCTGGCCAGACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 288} {0: 1, 1: 0, 2: 4, 3: 33, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!