ID: 1152789406_1152789411

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1152789406 1152789411
Species Human (GRCh38) Human (GRCh38)
Location 17:82270800-82270822 17:82270813-82270835
Sequence CCCTGATGGGTGGCTGTCTGGGA CTGTCTGGGACGGCTGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 158} {0: 1, 1: 0, 2: 3, 3: 16, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!