ID: 1152789902_1152789915

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1152789902 1152789915
Species Human (GRCh38) Human (GRCh38)
Location 17:82273329-82273351 17:82273370-82273392
Sequence CCGCTGCCGATCTTCCGGCCCAG TCTCAGCTCCATGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 86} {0: 1, 1: 0, 2: 1, 3: 16, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!