ID: 1152790056_1152790063

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1152790056 1152790063
Species Human (GRCh38) Human (GRCh38)
Location 17:82273850-82273872 17:82273865-82273887
Sequence CCCCTTCCACGTGCAGGCTCCTG GGCTCCTGCTGCTCTCGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 218} {0: 1, 1: 0, 2: 0, 3: 29, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!