ID: 1152807419_1152807427

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1152807419 1152807427
Species Human (GRCh38) Human (GRCh38)
Location 17:82362749-82362771 17:82362795-82362817
Sequence CCCTGCAGCTTGTCTCCATGGTG ACAGAAGATGACCCCAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 170} {0: 1, 1: 0, 2: 0, 3: 21, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!