ID: 1152809589_1152809600

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1152809589 1152809600
Species Human (GRCh38) Human (GRCh38)
Location 17:82375299-82375321 17:82375320-82375342
Sequence CCTGCGCGGCCGCGTGCGGGGCC CCCGGGCAGCGGGGGAGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 244} {0: 1, 1: 1, 2: 8, 3: 55, 4: 657}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!