|
Left Crispr |
Right Crispr |
| Crispr ID |
1152815803 |
1152815811 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:82407043-82407065
|
17:82407089-82407111
|
| Sequence |
CCCCATGTCTACTAAAAATACAA |
CTGTAATCCCAGCTGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1150, 1: 88102, 2: 176243, 3: 171464, 4: 104161} |
{0: 1, 1: 1, 2: 17, 3: 94, 4: 885} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|