|
Left Crispr |
Right Crispr |
| Crispr ID |
1152815804 |
1152815811 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:82407044-82407066
|
17:82407089-82407111
|
| Sequence |
CCCATGTCTACTAAAAATACAAA |
CTGTAATCCCAGCTGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1217, 1: 94042, 2: 246506, 3: 151734, 4: 74243} |
{0: 1, 1: 1, 2: 17, 3: 94, 4: 885} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|