ID: 1152817844_1152817855

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1152817844 1152817855
Species Human (GRCh38) Human (GRCh38)
Location 17:82418694-82418716 17:82418719-82418741
Sequence CCGGGCCTGGCTGCGCCCCCGGA TCGCGGGACCGCGGCGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 340} {0: 1, 1: 0, 2: 1, 3: 31, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!