ID: 1152818054_1152818062

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1152818054 1152818062
Species Human (GRCh38) Human (GRCh38)
Location 17:82420432-82420454 17:82420467-82420489
Sequence CCAGAAGCTAGAGAGAAGCAAGG CTTCAGCCTTCAGGGAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 32, 3: 162, 4: 563} {0: 1, 1: 0, 2: 4, 3: 31, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!