ID: 1152822031_1152822051

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1152822031 1152822051
Species Human (GRCh38) Human (GRCh38)
Location 17:82442335-82442357 17:82442382-82442404
Sequence CCCCGCTGCCACCCACCAGCCCT TGAGGGGAGAGCTCATGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 612} {0: 1, 1: 0, 2: 2, 3: 20, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!