ID: 1152822299_1152822309

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1152822299 1152822309
Species Human (GRCh38) Human (GRCh38)
Location 17:82443574-82443596 17:82443619-82443641
Sequence CCGAGGTCTTGCTGTGGCCCAAA ACCTCCGGCTGCAGAAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 171} {0: 1, 1: 0, 2: 1, 3: 11, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!