ID: 1152845360_1152845371

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1152845360 1152845371
Species Human (GRCh38) Human (GRCh38)
Location 17:82596471-82596493 17:82596501-82596523
Sequence CCCACCGGTTGCCCTGGTGCCCT CCCCGGGACCGCGCACACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 112} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!