|
Left Crispr |
Right Crispr |
| Crispr ID |
1152847563 |
1152847570 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:82611366-82611388
|
17:82611398-82611420
|
| Sequence |
CCCGGCTACTCAGGAGGCTGAGG |
CACGTGAATCCAGGAGACAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1159, 1: 100407, 2: 205957, 3: 239744, 4: 153584} |
{0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|