ID: 1152859873_1152859879

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1152859873 1152859879
Species Human (GRCh38) Human (GRCh38)
Location 17:82690112-82690134 17:82690162-82690184
Sequence CCAAGGGAAACCAGAAGAGTAGC CTGAAGAATCAGAGGGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 41, 4: 390} {0: 1, 1: 0, 2: 5, 3: 43, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!